Sub Problem 1

In: Business and Management

Submitted By Qdog
Words 493
Pages 2
Sub Problem 1
The purpose of this survey is too gather information from citizens, business, and educators of the surrounding communities that make-up Hardin to see if there is a need for higher education by identifying those potential students that have an interest in obtaining an Undergraduate or Graduate degree.
The group hypothesis is “individuals with a higher education level will perceive a greater need for adult higher education than those with lower education levels”. The null hypothesis is “individuals with a higher educational level will not perceive a greater need for adult higher education than those with lower education levels”.
According to the 2010 census, Hardin County has an estimated population of approximately 107,456. 18.5% of Hardin County population has a bachelor degree in the age group of 25 plus, which is approximately 2% below the state average. Within the same age range the county high school graduation rate is 87.4% which is 6% above the state average. The census data clearly shows that there is a large group of applicants within the area that the university can recruit.
The survey questions was developed in conjunction with Webster University representative Dr. Brian Daly to help the group obtain the necessary information that will allow the team to submit recommendations that will increase the Undergraduate and Graduate student body population at Webster University Radcliff campus. All questions where inputted into Survey Monkey and the link was distributed throughout the community through various sources i.e. email, education center, Facebook, and newspapers.
The Survey asked the following questions: 1. How much do you agree or disagree with each of the following statements about education in this community? 2. Are you currently enrolled as a student? 3. How likely is it that you would pursue more education if…...

Similar Documents

Practice-Problem-1

...Practice problems – Set I 1. A bank classifies borrowers as high-risk or low-risk. Only 15% of its loans are made to those in high-risk category. Of all its loans, 5% are in default, and 40% of those in default were made to high-risk borrowers. What is the probability that a high-risk borrower will default? 2. A fund manager is considering investing in the stock of a healthcare provider. The manager’s assessment of probabilities of the rates of return on this stock over the next year is summarized in the table below. Rate of return Less than -10% -10% to 0% 0% to 10% 10% to 20% More than 20% Probability 0.04 0.14 0.28 0.33 0.21 Let A be the event “Rate of return will be more than 10%,” and B be the event “Rate of return will be negative.” • Find the probability of events A and B. • Describe the even that is complement of event A. • Find the probability of the complement of A. • Describe the even that is complement of event B. • Find the probability of the complement of B. • Describe and find the probability of event that is intersection of A and B. • Describe and find the probability of event that is union of A and B. • Are events A and B mutually exclusive? Collectively exhaustive? 3. A random sample of 52 personal property insurance policies showed the following number of claims over the last year: # of claims 0 1 2 3 4 5 6 # of policies 21 15 5 4 2 3 2 • Find the mean number of claims per day. • Find the sample variance and standard......

Words: 413 - Pages: 2

Mba510 Problem Set 1

...Week 3 Problem Set 1: Chapter 3: 62, 72 62) The Citizens Banking Company is studying the number of times the ATM located in a Lob laws Supermarket at the foot of Market Street is used per day. Following are the numbers of times the machine was used over each of the last 30 days. Determine the mean number of times the machine was used per day. 83 64 84 76 84 54 75 59 70 6163 80 84 73 68 52 65 90 52 7795 36 78 61 59 84 95 47 87 60 Answer: The ATM machine was used a mean number of times 70. 53. 72.) The weights (in pounds) of a sample of five boxes being sent by UPS are: 12, 6, 7, 3, and 10. 1. Compute the range. 3-12 2. Compute the mean deviation. 7.6 3. Compute the standard deviation. Chapter 5, 66 66) A survey of undergraduate students in the School of Business at Northern University Revealed the following regarding the gender and majors of the students: Major Gender Accounting Management Finance Total |Gender |Accounting |Major/management |Finance |Total | |Male |100 |150 |50 |300 | |Female |100 |50 |50 |200 | |Total |200 |200 |100 |500 ......

Words: 478 - Pages: 2

Week 1 Problems and Exercises

...Problems and Exercises Week 1 Chapter 1 1. Why is it important to use systems analysis and design methodologies when building a system? Why not just build the system in whatever way seems to be “quick and easy?” What value is provided by using an “engineering” approach? It is important to use system analysis and design methodologies when building a system because it helps identify the problem to be solved and what the goal of the system should be. If you just started the fastest way you would most likely miss the reason for building it plus you may only create more problems. The value added is utilizing the time and resources you have most efficiently. By not using an engineering approach you risk too much waste. 8. How might prototyping be used as part of the SDLC? Prototyping can be used as a tool to help identify what users want from the system being designed. It aids the analyst in the SDLC process to help provide answers as to what users may want. Chapter 2 3. In the section on choosing off-the-shelf software, eight criteria are proposed for evaluating alternative packages. Suppose the choice is between alternative custom software developers rather than prewritten packages. What criteria would be appropriate to select and compare among competing bidders for custom development of an application? Define each of these criteria. Cost – the total cost of the application which includes all aspects from development to installation......

Words: 426 - Pages: 2

Assignment 1 Problem Answers

...Unit 1 Assignment 1 Problems Chapter 1: Problem 5, A-D, Page 21 Chapter 3: Problem 7, A-D, Page 68 Angela Besler Capella University MBA6008 January 12, 2014 Unit 1 Assignment 1 Problems Chapter 1: Problem 5, A-D, Page 21 A. Table and Graph: Types of Production |   | Automobiles | Forklifts | | 0 | 30 | A | Production Alternatives | 2 | 27 | B | | 4 | 21 | C | | 6 | 12 | D | | 8 | 0 | E | | A production possibility “curve displays the different combinations of goods and services that society can produce in a fully, employed economy, assuming a fixed availability of supplies of resources and fixed technology” (McConnell and Et. Al., 2012). The specific assumptions that a production possibilities curve has is that of: * Full employment: employing all available resources * Fixed resources: quantity/quality of production factors fixed * Fixed technology: methods used to produce output(state of technology) constant * Two goods: economy produce only two goods; both consumer and capital goods (McConnell and Et. Al., 2012). “Each point on the curve represents some maximum output of two products” (McConnell and Et. Al., 2012). “Gross Domestic Production (GDP is the total market value of all final goods/services produced annually within boundaries of US, whether by US or foreign supplied resources” (McConnell and Et. Al., 2012). “Net Domestic Production (NDP) is the GDP less part of the year’s output that needed to......

Words: 1236 - Pages: 5

Financial Problem Part 1

...Financial Reporting Problem, Part 1 ACC/290 April 20, 2014 Abstract In this paper we will discuss Walmart’s Balance sheet and Income Statement. We will analyze the company’s total assets at the end of the most recent annual reporting year and to why it is important. We then will talk about the company’s total assets, how much cash and cash equivalents did the company have, as well as, the amount of accounts payable at the most recent year, and from the previous year. What the company’s net revenues are from the last three annual reporting periods, the change in dollars in the company’s net income from the most recent annual reporting period to the previous annual reporting period. We will talk about the company’s total assets at the end of the most recent year and the previous year from the annual reporting period. Lastly, we will discuss as to what information that has been obtained within this paper that would be important to a potential investor, employee and so forth. Financial Reporting Problem, Part 1 Total Assets The total assets for Wal-Mart as of January 31, 2013 were $203,105,000. The reason this is important for a company or business to know, is so the business can have a better understanding of how much the company is worth. Knowing how much a company is worth is beneficial because the assets can be used as collateral for a loan. Also knowing the assets and comparing total assets to previous...

Words: 1403 - Pages: 6

Unit 1. Problem Set 1. Unit 1 Problems

...Fill in the blank Page 24 1. The general Public in the United States will be able to purchase all of the Windows 7 editions in retail stores except starter, home basic, and enterprise. 2. The core module that provides all of the Windows 7 capability that isn’t language- or edition specific is called minwin. 3. When you copy a file to a library, Windows Explorer writes the file to the folder designated as the save location. 4. To use federated search, you must download or create XML files for specific sites called search connectors. 5. The only operating system edition that you can upgrade in-place to Windows 7 Professional is windows vista business. 6. Upgrading a computer running Windows 7 Starter to Windows 7 Ultimate using Windows Anytime Upgrade requires 0 megabytes of additional hard disk space. 7. To migrate a computer running Windows XP to Windows 7, you can use a utility called user state migration tool. 8. The new Windows 7 feature that renders all of the windows on the desktop transparent when you mouse over the right end of the taskbar is called aero peek. 9. The Windows 7 Starter edition is only available in a 32-bit version. 10. The maximum amount of system memory supported by Windows 7 Enterprise is 192 GB (64bit). Fill in the blank page 61 1. side-by-side, wipe-and-load 2. Windows recovery environment 3. windows easy transfer, USMT 4. 72 hours of continuous operation 5. floppy disks 6.......

Words: 267 - Pages: 2

Macroeconomics Problem Set 1

...Amanda Taliaferro ECON214-B12 Problem Set #1 August 26, 2014 Problem Set 1 Complete all questions listed below. Clearly label your answers. 1. The receipts and year of release of the five movies with the largest nominal box office revenues, along with the CPI data of each year are presented below. Assuming that the receipts for each of the movies were derived during their year of release, convert the receipts for each to real dollars for the year 2010 (2010 CPI 218.1). Put the movies in order from largest to smallest real box office receipts. Movies | NominalBox Office Receipts (millions) | Year Released | CPI in Year Released. | Avatar | $760.50 | 2009 | 214.5 | Titanic | 600.8 | 1997 | 160.5 | Star Wars | 461 | 1977 | 60.5 | Shrek 2 | 437.2 | 2004 | 188.9 | E.T. The Extra-Terrestrial | 399.9 | 1982 | 96.5 | Star Wars= $1664.21 E.T.= $903.77 Titanic= $817.09 Avatar= $773.43 Shrek= $507.15 2. Classify each of the following as employed, unemployed, or not in the labor force. a. Beth is not working; she applied for a job at Wal-Mart last week and is awaiting the result of her application. Beth is unemployed. b. Juan is vacationing in Florida during a layoff at General Motors plant due to a model changeover, but he expects to be recalled in a couple of weeks. Juan is unemployed. c. Bob was laid off as a carpenter when a construction project was completed. He is looking for work but has been unable to find anything......

Words: 623 - Pages: 3

Problem Set 1

...Problem Set 1 MGT-309 – Intro to Logistics Management November 23, 2014 Cosme Lucio Professor Jerry Bilbrey 2a. 2*8*44,000=704,000 .12*.75=.09 704,000/.09= 7,822,222.222222222 = 2796.823595120404 = 2797 2b. Inventory Carrying Costs = (2,797/2)*0.75*12% = $125.87 Order Costs = (44,000/2797) = 15.73 = 16, 16*$8(per order) = $128.00 Transportation Costs = 44,000 units *0.05 per unit = 2,200 (Q=2,797) = 125.87+128+2,200= 2453.87 Inventory Carrying Costs = (4,000/2)*.075*12% = $180 Order Costs = 44,000/4,000 = 11orders, 11orders*$8 per order = $88 Transportation Costs = 44,000*$0.04 per unit = $1760.00 (Q=4,000) = 180+88+1,760 = 2,028 2c. 4,000 CUPS = 11 orders, 33 days between orders 4a. Common days’ supply of chocolate chewies at DC: DS= [(42,000 – 7,000) + 18,500]/4,500 = 11.8888889 = 12(Rounded Up) 4b. Fair Share Allocation Logic: Cincinnati Allocation = (11.8888889 * 2,500) – 12,500 = 17,222.2222 Phoenix Allocation = (11.8888889 * 2,000) – 6,000 = 17,777.7778 6a. Yes. The demand never exceeded what was in stock and causing a stockout. 6b. SD = 1.811 6c. Yes. The frequency wasn’t out of bounds with mean, mode, median. 6d. SD = 1.095445 6e. SD of Combined Probabilities = 6 6g. f(k) = 0.061667 6h. k = 1.1, Required safety stock for the desired 99 percent is 6.42 with an average inventory of 36 6i....

Words: 252 - Pages: 2

Economics Problems Set 1

...MBA-FP6008: Assessment 1, Economics Problem Set 1 Dennis J. Johnson Capella University 08/12/2015 Problems A, B, and C Introduction This assessment will be an analysis of graphed data and changes in supply and demand for three economic problems. Problem A involves production possibilities for consumer and capital goods, problem B is an evaluation of changes in supply and demand equilibrium, and finally, problem C involves pricing with relevance to supply and demand. Successful completion of this assessment demonstrates proficiency in; applying theories, models, and practices of economic theory, analyzing solutions with support from relevant data, resources, references, and economic principles, analyzing graphed and circular flow diagram data, and analyzing changes in supply and demand in a competitive market. Problem A. Production Possibilities | Type of Production | Production Alternative A | Production Alternative B | Production Alternative C | Production Alternative D | Production Alternative E | Butter | 0 | 1 | 2 | 3 | 4 | Guns | 15 | 14 | 12 | 9 | 0 | Production Possibilities for Consumer Goods (Guns) and Capital Goods (Butter) 1. The specific assumptions that underlie the production possibilities curve are: that there are only two goods, consumer and capital, that they are produced in different proportions in the economy, the quantities of the resources do not change, production techniques are given and constant, and that resources......

Words: 1353 - Pages: 6

Problem Set 1

...Problem 1 a. What do you expect tuition and housing at top private schools to cost during Mary’s first year at college? PV=35,000; r=4%; N=18-5=13 FV=PV*(1+r)n =35,000*1+4%13 =58277.57 b. In nominal dollars, how much must be in the savings account on Mary’s 18th birthday after the last deposit has been made but before the first tuition and housing payment? PV18=58277.57; g=4%; r=10%*(1-τ)=10%*(1-30%)=7%; N=3 Pmt19=PV18*1+g=58277.57*1+4%=60608.67 The present value of year 18-21 at 18th year is: PV18-21=PV18+Pmt19r-g(1-(1+g1+r)N) =58277.57+60608.677%-4%1-1+4%1+7%3 =223488.53 c. What should be the amount of the first deposit to the savings account? FV=223488.53; r=10%*(1-τ)=10%*(1-30%)=7%; g=2%; N=18-5=13 Pmt1=FV1+rN-1+gNr-g =223488.531+7%13-1+2%137%-2% =10010.79 d. Alternatively, Mary’s parents could open a 529 account that allows college savings to grow tax-free. If they saved in this account rather than in a normal investment fund, and still earned the same pre-tax return, how much should be their first deposit? PV18=58277.57; g=4%; r=10%; N=3; Pmt19=PV18*1+g=58277.57*1+4%=60608.67 The present value of year 18-21 at 18th year is: PV18-21=PV18+Pmt19r-g(1-(1+g1+r)N) =58277.57+60608.6710%-4%1-1+4%1+10%3 =214721.71 FV=214721.71; r=10%; g=2%; N=18-5=13 Pmt1=FV1+rN-1+gNr-g =214721.711+10%13-1+2%1310%-2% =7957...

Words: 1347 - Pages: 6

Unit 1 Problem Set

...Networking Unit 1 Problem Set 1 Lesson 1 1. the general public in the United States will be able to purchase all of the Windows 7 editions in retail stores except... Starter, Home basic and Enterprise. 2. the core module that provides all of the Windows 7 capability that isn't language- or edition-specific is called... MinWin Module. 3. When you copy a file to a library, Windows Explorer writes the file to the folder designated as the … Save Location. 4. To use federated search, you must download or create XML files for specific sites called... Connectors. 5. The only operating system edition that you can upgrade in-place to Windows 7 Professional is... Windows 7 Ultimate. 6. Upgrading a computer running Windows 7 Starter to Windows 7 Ultimate using Windows Anytime Upgrade requires Blank megabytes of additional hard disk space. 0 7. to migrate a computer running Windows XP to Windows 7, you can use a utility called... Windows 7 Upgrade Advisor. 8. the new Windows 7 feature that renders all of the windows on the desktop transparent when you mouse over the right end of the taskbar is called... Aero Pack. 9. the Windows 7 Blank edition is only available in a 32-bit version. Starter 10. The maximum amount of system memory supported by Windows 7 Enterprise is... 192GB. Lesson 2 1. Windows Easy Transfer supports two types of migrations, called Blank and Blank. Wipe and Load & Side by Side 2. When a serious problem......

Words: 474 - Pages: 2

Week 1 Problem Set

...Week 1 Problem Set Answer the following questions and solve the following problems in the space provided. When you are done, save the file in the format flastname_Week_1_Problem_Set.docx, where flastname is your first initial and you last name, and submit it to the appropriate dropbox. Chapter 1 (page 19) 1. What is the most important difference between a corporation and all other organizational forms? 2. What does the phrase limited liability mean in a corporate context? 3. Which organizational forms give their owners limited liability? 4. What are the main advantages and disadvantages of organizing a firm as a corporation? 5. Explain the difference between an S corporation and a C corporation. Chapter 2 The following is provided for use in answering the next set of questions. You may also find table 2.5 on page 53 of your text and all questions on pages 56–57. ------------------------------------------------- TABLE 2.5 2009–2013 Financial Statement Data and Stock Price Data for Mydeco Corp. Mydeco Corp. 2009–2013 | (All data as of fiscal year end; in $ million) | Income Statement | 2009 | 2010 | 2011 | 2012 | 2013 | RevenueCost of Goods Sold | 404.3(188.3) | 363.8(173.8) | 424.6(206.2) | 510.7(246.8) | 604.1(293.4) |    Gross ProfitSales and MarketingAdministrationDepreciation and Amortization | 216.0(66.7)(60.6)(27.3) | 190.0(66.4)(59.1)(27.0) | 218.4(82.8)(59.4)(34.3) | 263.9(102.1)(66.4)(38.4) | 310.7(120.8)(78.5)(38.6) | ......

Words: 958 - Pages: 4

Problem Set 1

...Problem set 1 Exercise 1 Giving €10 to a friend does not affect GDP because it is just an exchange of paper and there is no new production. Because she loses the money, she cannot go to the movies, so she cannot consume anything. That transaction does not affect France's 2014 GDP. Expenditure: consumption in services increase by €50 (only the service fee and not the loan). Income side: wages and profits should increase by €50. Value added: services value added should increase by €50. Expenditure: consumption in goods increases, but imports also increases. GDP stays the same. Income side: it does not increase in France but in the US. Value added: it increases in the US and not in France Winning the lotery is just a money transfer, it does not involve production, therefore it does not affect GDP. It is legalized so it should count in GDP and increase it, but because it is domestic production, it is not meant to be sold, so it does not affect GDP. Expenditure: consumption in non-durable goods increases by €105. Income side: wages plus profits shoul increase by €105. Value added: Restaurants value added should increase by €105. Exercise 4 (i) NominalGDP2012 = QuantityTV * PriceTV2012 + QuantityComputers * PriceComputers2012 = 100*500+20*1,000 NominalGDP2012= €70,000 NominalGDP2013 = QuantityTV * PriceTV2013 + QuantityComputers * PriceComputers2013 = 80*400+30*1,200 NominalGDP2013= €68,000 NominalGDP2014 = QuantityTV *......

Words: 930 - Pages: 4

Problem Set 1

...Problem Set 5: 1) Advantages include the fact that polyclonal is cheaper, a mixture of different antibodies are made while monoclonal is only one specific antibody (this might depend on the experiment as some might prefer different antibodies), and large quantities are made. Disadvantages are that the affinities of the antibodies differ, a good amount of a specific antibody can’t be made alone unlike monoclonal, it is less reliable, and the same sample can’t be guaranteed each time unlike the monoclonal which can bring similar clones months later. 3) The GFP-HDAC3 overlaps the DAPI where the nucleus is. This shows that HDAC3 is a nuclear protein. However, some deletions show that the nucleus has gone smaller while others show that the nucleus has gone larger. The goal of this experiment was to find out how the different portions of the protein affected localization in the cell. The experiment does show that there was a significant effect. 4) Sense: 5’ aagccccatcgcctggcattg 3’ Linker Loop: 5’ uucaagaga 3’ Antisense: 5’ caatgccaggcgatggggctt 3’ Poly U: UUUUU The goal of the knockout would be to see if the removed proteins had any effect on the function of the cell. The siRNA should be 30%-50% GC content, 21 bp in length, have a AA on the 5’ end, a linker, around 75 bp ds of the gene, and have a poly U tail. These conditions are satisfied but the GC content is slightly high. 5) Fold increase in HDAC3 mRNA gene in control vs experiment = 1488/151= 9.85 fold......

Words: 364 - Pages: 2

Problem Set 1

...Problem Set 1 Problem 1 Which project should the firm select? Why? Project B: Managers should try to maximize their stock’s intrinsic value while also bringing in revenue. The P/E ratio shows the dollar amount investors will pay for $1 of current earnings. Problem 2 If most investors expect the same cash flows from Companies A and B but are more confident that A’s cash flows will be closer to their expected value, which company should have the higher stock price? Explain. The primary goal of a corporation should be to maximize its owner’s value. If a manager is to maximize shareholder wealth, he/she must know how that wealth is determined. Fundamentally, shareholder wealth is the number of shares outstanding at times the market price per share. A stock’s price at any given time depends on the cash flows a “marginal” investor expects to receive after buying the stock. With that being said, Company A’s cash flow would increase the stock price and the risk would be minimal. Management’s goal should be to make decisions designed to maximize the stock’s price. Problem 3 The president of Southern Semiconductor Corporation (SSC) made this statement in the company’s annual report: “SSC’s primary goal is to increase the value of our common stock holders’ equity.” Later in the report, the following announcements were made: a. The company contributed $1.5 million to the symphony orchestra in Birmingham, Alabama, its headquarters city b. The company is spending $500......

Words: 628 - Pages: 3

Cool Photoshop Action 2012 pack 378 | Marvel Rising: Initation | Lançamentos em 1940